Article Information

• PDF (259 kb)
• Full Text with Large Figures
• Supporting Material
• Cited by in Scopus (7)

PubMed

• Articles by J. Bishop
• Articles by S. Blair

Related Articles

• A Competitive Kinetic Model of Nucleic Acid Surface Hybridiz...

  A Competitive Kinetic Model of Nucleic Acid Surface Hybridization in the Presence of Point Mutants Biophysical Journal, Volume 90, Issue 3, 1 February 2006, Pages 831-840 J. Bishop, S. Blair and A.M. Chagovetz Abstract Microarray analysis has become increasingly complex due to the growing size of arrays and the inherent cross-binding of targets. In this work, we explore the effects of matched and mismatched target species concentrations, temperature, and the time of hybridization on sensing specificity in two-component systems. A finite element software is used to simulate the diffusion of DNA through a microfluidic chamber to the sensing surface where hybridization of DNA is modeled using the corresponding kinetic equation. Comparison between a single-component system, where only one target is allowed to bind to a specific zone, and a two-component system, where more than one target can hybridize in a sensing zone, uncovers significant kinetic disparities during the transitory state; however, at thermodynamic equilibrium a modified Langmuir isotherm governs the bound amount of both species. The results presented suggest that it may be more appropriate to consider collective rather than quasi-independent interaction of targets in multicomponent systems. Abstract | Full Text | PDF (175 kb)

• Multiplex SNP Discrimination

  Multiplex SNP Discrimination Biophysical Journal, Volume 92, Issue 10, 15 May 2007, Pages L89-L91 Daniel J. Fish, M. Todd Horne, Robert P. Searles, Greg P. Brewood and Albert S. Benight Abstract Multiplex hybridization reactions of perfectly matched duplexes and duplexes containing a single basepair mismatch (SNPs) were investigated on DNA microarrays. Effects of duplex length, G-C percentage, and relative position of the SNP on duplex hybridization and SNP resolution were determined. Our theoretical model of multiplex hybridization accurately predicts observed results and implicates target concentration as a critical variable in multiplex SNP detection. Abstract | Full Text | PDF (235 kb)

• Kinetics of Multiplex Hybridization: Mechanisms and Implicat...

  Kinetics of Multiplex Hybridization: Mechanisms and Implications Biophysical Journal, Volume 94, Issue 5, 1 March 2008, Pages 1726-1734 J. Bishop, A.M. Chagovetz and S. Blair Abstract Quantitative analysis of DNA microarray data is complicated by uncertainties inherent to the experimental setup. Using computer simulations and real-time experimental results, we have previously demonstrated effects of multiplex reactions on a single sensing zone of an array, which may be a leading factor in erroneous interpretation of experimental data. We suggest here that a simplified three-component kinetic model may present a sufficient approximation to describe the general case of DNA sensing in a complex sample milieu. We show that, by analyzing the real-time hybridization kinetics of a nontarget species, we can perform quantitative analysis of unlabeled targets of interest within a broad dynamic range of concentrations. Abstract | Full Text | PDF (1138 kb)

• …more

Copyright © 2007 The Biophysical Society. All rights reserved.
Biophysical Journal, Volume 92, Issue 1, L10-L12, 1 January 2007

doi:10.1529/biophysj.106.097121

Biophysical Letters

Competitive Displacement of DNA during Surface Hybridization

J. Bishop^*, C. Wilson^*, A.M. Chagovetz^* and S. Blair^*, ,  

^* Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, Utah 84084

Address reprint requests and inquiries to S. Blair.

Competitive surface hybridization has been implicated as a mechanism affecting the quantative interpretation of DNA microarray data, especially in the presence of single nucleotide polymorphism 1,2,3. Tawa et al. have analyzed composite hybridization curves 4 and suggested that errors in analysis originated from competition between two or more species. Recently, competitive hybridization between two DNA species has been modeled 5,6, demonstrating the nonlinear dynamic behavior of each species that is not observed in the composite signal.

Competition between different targets hybridizing to the same probe site produces two effects that adjust hybridization rates. The first is the reduction in binding sites due to hybridization of multiple targets, and the second is the displacement of lower affinity targets by higher affinity targets. In this Letter, we provide, to our knowledge, the first direct experimental evidence of the displacement of low affinity targets during surface hybridization by monitoring the individual components of a two-component hybridization for two model systems containing a 20 base wild-type sequence and an SNP sequence. In one of the systems used, the wild-type sequence folds. The experimental results clearly show the higher concentration species dominate the initial phase of hybridization, whereas during the second, competitive, phase, the match (i.e., higher affinity) species displaces the mismatch.

A detailed description of experimental methodology is presented in the Supplementary Material ; here we provide a brief description. Hybridization experiments were carried out using quartz microscope slides with an epoxysilane surface vapor deposited in-house. Hybridization and control spots of ∼400μm diameter were also spotted in-house. Hybridization experiments were performed at 40°C, with temperature control provided by a Peltier device. At the beginning of each experiment, a 50μL of sample was injected into a coverslip provided by BioMicro Systems (Salt Lake City, UT). The temperature was then raised to melt any initial duplexes formed, and reduced to the hybridization temperature, at which point data collection was performed.

Real-time detection was realized using the quartz slide as an optical waveguide 7. The evanescent field produced by end-fire coupling 532nm and 635nm lasers allowed selective excitation of surface bound species with respect to solution fluorescence. In all experiments, the wild-type target (CGCGGGCCGCATTAATAAAC for Set 1 and CGAGGGCAGCATTAGTACAC for Set 2) was labeled with Cy-3 and the SNP target (CGCGGGCCGTATTAATAAAC for Set 1 and CGAGGGCAGCAATAGTACAC for Set 2) was labeled with Cy-5. Fluorescence was collected using a charge-coupled device camera with an attached filter wheel containing interference bandpass filters corresponding to the emission of Cy-3 and Cy-5. Intensity data obtained during hybridization experiments for Cy-3 and Cy-5 on the same spot were normalized using control spots. One control spot had labeled Cy-3 probe whereas the other had Cy-5 labeled probe; these probe sequence were not complementary to any of the sequences used for hybridization.

Initial experimental results were obtained from Set 1 with probe spot sequences fully complementary to either the wild-type or SNP target; equimolar concentrations of wild-type and SNP were used in a two-component sample. Note that the wild-type sequence (unlike the SNP) contains a stable folded state at 40°C, as determined by Quikfold 7, an effect that was not accounted for in our earlier modeling study 5. Figure 1A shows the measured individual and composite signals for hybridization to the wild-type spot. During the first phase of hybridization, the SNP dominates because of its higher “active” concentration with respect to the wild-type, as discussed below. However, when the total bound target concentration begins to approach the equilibrium value, there is a competitive regime during which the lower-affinity, SNP, is displaced by the higher-affinity, wild-type, species. This behavior was predicted from the modeling studies 5,6, and has not been observed before because only composite hybridization curves have been monitored. Similar results are obtained with a probe spot perfectly complementary for the SNP, shown in Figure 1B. In this case, the SNP sequence is the perfect match, and having higher “active” concentration than the folding wild-type sequence, the composite and match curves follow each other closely, whereas the displacement of the mismatch species is clearly evident.

Display large version of this figure

Figure 1

Real-time hybridization curves for a wild-type (30nM, green), SNP (30nM, red), calculated composite curve (A and B) consisting of wild-type plus SNP hybridization (black). (A) Two-component sample of wild-type (match) and SNP (mismatch) showing competitive hybridization on a spot matched to the wild-type target, the composite curve decreases slightly due to probe density difference between the control spots. (B) Two-component sample of SNP (match) and wild-type (mismatch) showing competitive hybridization on a spot matched to the SNP. (C) single component traces of match and mismatch hybridization on a spot matched to the wild-type target (overlay of two independent experiments).

An assumption sometimes is that multi-component DNA (i.e., mixed sample) hybridization can be treated as a superposition of single-component DNA hybridizations 8. Using the sequences from Set 1, we performed single-component experiments by allowing the wild-type and target SNP to hybridize to the wild type sensing zones independently. Our results demonstrate (Figure 1C) that there are differences in the hybridization curves between a multi-component experiment and single-component experiment. Most importantly, during the single-component experiment, the mismatch (SNP) species hybridizes to the wild-type spot with significant affinity and monotonically increases. (This result also shows that photobleaching is not the cause of signal reduction observed during two-component hybridization). During the two-component experiment, initial growth of the mismatch is followed by displacement due to competition. Therefore, interpreting the composite curve as a single component or as a superposition of single components leads to significant misquantification of the matched species and may result in false positive calls. Note, in single component experiments, the signals originate from individual hybridizations (Figure 1C); however, in multi-component samples, uniformly labeled by one fluorescent dye, only the composite signal is observed.

Another source of quantification error in DNA microarray experiments is the differences in folding patterns of the sequences in solution, as is common in SNP detection 9. Our experimental results show that, since the rate of folding is typically faster than hybridization 10, the effects of secondary structures can be described by a reduction in the “active” (unfolded) concentration of the folding species involved. As a result, the “active” concentration can be described as C_eff ∼ C_oK_eq/(1+K_eq), where C_o is the total target concentration and K_eq=k_uf/k_f=e^ΔG/RT. Using ΔG=−1.2kcal/mol calculated using Quikfold 7, the “active” concentration at T=40°C should be ∼3.8nM if C_o=30nM.

Fig. 2 shows results of two-component hybridization after accounting for the reduction of “active” wild-type concentration by decreasing the SNP concentration 10-fold. The competition appears to occur between two targets of nearly equal concentrations 5, suggesting that, due to folding, the “active” wild-type concentration is reduced by a factor of ∼10, agreeing well with the calculation.

Display large version of this figure

Figure 2

Individual hybridization curves for the wild-type (match 30nM) and SNP (mismatch 3nM) target showing competitive hybridization after compensation for the reduction of active wild-type concentration due to sequence folding. Probe was complementary to the wild-type.

To investigate a system with no secondary structures at the experimental temperature of 40°C, we also performed experiments with Set 2. As shown in Fig. 3, for equimolar concentrations of wild-type and SNP species in a mixed sample, during the first phase of hybridization, the on rates are essentially the same, and during the second phase, competitive displacement of the mismatch occurs. However, the maximum surface concentration of the SNP remains lower than that of the wild-type target and during the displacement phase the SNP is nearly eliminated. These results further corroborate the published simulation data 5,6.

Display large version of this figure

Figure 3

Experimental traces of hybridization to a spot fully complementary to the wild-type sequence from Set 2 using a mixed sample of wild-type (match, green) and SNP (mismatch, red) target from Set 2 at equal concentrations of 30nM for a system where no secondary structures are formed.

Using two-component, mixed samples we have presented the first direct experimental evidence of the kinetic competition by real-time monitoring of matched and mismatched targets at the sensing zone for two different model systems. Even though our experiments do not emulate a complete array, the effects of competitive DNA hybridization would only increase as the number of target species increases. However, our results prove that competitive displacement occurs, and is a mechanism that should be accounted for during the analysis of DNA microarray data. In cases of lower target concentrations, the trends shown would be the same, but the timescale would be elongated.